ID: 975413573_975413577

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 975413573 975413577
Species Human (GRCh38) Human (GRCh38)
Location 4:74083030-74083052 4:74083064-74083086
Sequence CCTATACATAAACAAGCATTGTA CACGTTCCTCCTCTTTCTTTTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 35, 3: 75, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!