ID: 975451368_975451376

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 975451368 975451376
Species Human (GRCh38) Human (GRCh38)
Location 4:74530681-74530703 4:74530721-74530743
Sequence CCTGTAGTCCCAGCTACTTGGGA CACTTGAATCAAGGAGGCGGAGG
Strand - +
Off-target summary {0: 41425, 1: 153414, 2: 219429, 3: 225665, 4: 454725} {0: 3, 1: 491, 2: 10053, 3: 50717, 4: 117241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!