|
Left Crispr |
Right Crispr |
| Crispr ID |
975451369 |
975451376 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:74530689-74530711
|
4:74530721-74530743
|
| Sequence |
CCCAGCTACTTGGGAGACTGAGG |
CACTTGAATCAAGGAGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3992, 1: 102915, 2: 212635, 3: 250751, 4: 264126} |
{0: 3, 1: 491, 2: 10053, 3: 50717, 4: 117241} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|