ID: 975451371_975451376

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 975451371 975451376
Species Human (GRCh38) Human (GRCh38)
Location 4:74530690-74530712 4:74530721-74530743
Sequence CCAGCTACTTGGGAGACTGAGGC CACTTGAATCAAGGAGGCGGAGG
Strand - +
Off-target summary {0: 3291, 1: 90134, 2: 199622, 3: 238811, 4: 230148} {0: 3, 1: 491, 2: 10053, 3: 50717, 4: 117241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!