ID: 975525001_975525008

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 975525001 975525008
Species Human (GRCh38) Human (GRCh38)
Location 4:75339357-75339379 4:75339404-75339426
Sequence CCATCTGCAACCTTAATTCCCCT CAGTTTCCAGGAATCAGATGTGG
Strand - +
Off-target summary {0: 26, 1: 84, 2: 177, 3: 275, 4: 519} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!