ID: 975735027_975735032

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 975735027 975735032
Species Human (GRCh38) Human (GRCh38)
Location 4:77372685-77372707 4:77372735-77372757
Sequence CCCACTTGTGAGTTGTAGCTCTG TAATTCCCCTCCTACTGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 101} {0: 1, 1: 1, 2: 0, 3: 9, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!