ID: 975735027_975735033

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 975735027 975735033
Species Human (GRCh38) Human (GRCh38)
Location 4:77372685-77372707 4:77372736-77372758
Sequence CCCACTTGTGAGTTGTAGCTCTG AATTCCCCTCCTACTGGTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 101} {0: 1, 1: 1, 2: 0, 3: 4, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!