ID: 975870696_975870701

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 975870696 975870701
Species Human (GRCh38) Human (GRCh38)
Location 4:78776124-78776146 4:78776147-78776169
Sequence CCTGCGGGTTTGTGGCCTGAGAC GTCTAGCCCACTCCCTGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!