ID: 975966537_975966543

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 975966537 975966543
Species Human (GRCh38) Human (GRCh38)
Location 4:79979264-79979286 4:79979292-79979314
Sequence CCAGGAGTAGTGGAAAGCCCTAC CCAAGGACATCACCAAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70} {0: 1, 1: 0, 2: 0, 3: 13, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!