|
Left Crispr |
Right Crispr |
Crispr ID |
976000610 |
976000614 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:80370080-80370102
|
4:80370094-80370116
|
Sequence |
CCTCAGGAAACTTACAATTATGG |
CAATTATGGCAGAGGGTGAAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 477, 1: 6480, 2: 8361, 3: 6485, 4: 4125} |
{0: 4, 1: 136, 2: 1522, 3: 2744, 4: 5086} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|