|
Left Crispr |
Right Crispr |
| Crispr ID |
976106048 |
976106055 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:81618623-81618645
|
4:81618657-81618679
|
| Sequence |
CCTTCCACCTTGGCCTTCCAAAG |
CAGGCATGAGCCACTGTGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 7444, 1: 30963, 2: 79445, 3: 137491, 4: 151300} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|