ID: 976112296_976112302

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 976112296 976112302
Species Human (GRCh38) Human (GRCh38)
Location 4:81688929-81688951 4:81688952-81688974
Sequence CCATAGCTGAACACCACAAGAAC GGGAGCAGTGGTAGAGGTGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 49, 4: 625}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!