ID: 976112296_976112303

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 976112296 976112303
Species Human (GRCh38) Human (GRCh38)
Location 4:81688929-81688951 4:81688955-81688977
Sequence CCATAGCTGAACACCACAAGAAC AGCAGTGGTAGAGGTGATGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 109, 4: 825}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!