ID: 976184352_976184357

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 976184352 976184357
Species Human (GRCh38) Human (GRCh38)
Location 4:82430002-82430024 4:82430053-82430075
Sequence CCGGCGCTGGCGACTGAGGCGGC TGTTTTGTCCTCGAGCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130} {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!