ID: 976441905_976441908

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 976441905 976441908
Species Human (GRCh38) Human (GRCh38)
Location 4:85085565-85085587 4:85085588-85085610
Sequence CCTGAGTTGCTCTTTATTGGGAA GATCTTAACCAGAAGCCGGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!