ID: 976473072_976473081

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 976473072 976473081
Species Human (GRCh38) Human (GRCh38)
Location 4:85452207-85452229 4:85452251-85452273
Sequence CCCTGACAGATAGTTGAATGACT GACAGCTGAGCAAAGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 117} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!