ID: 976499422_976499429

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 976499422 976499429
Species Human (GRCh38) Human (GRCh38)
Location 4:85770389-85770411 4:85770430-85770452
Sequence CCAATAGTCCTCCTATTGTTCAC CTTCCTAGGTTTGTTTTCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 117} {0: 1, 1: 0, 2: 4, 3: 65, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!