ID: 976608673_976608681

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 976608673 976608681
Species Human (GRCh38) Human (GRCh38)
Location 4:87007016-87007038 4:87007049-87007071
Sequence CCCGCGTTGTGCTGTTGCTGGGC CGCCGGCGGTCTTCGAGCGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 1220} {0: 1, 1: 0, 2: 0, 3: 0, 4: 11}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!