ID: 976768205_976768208

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 976768205 976768208
Species Human (GRCh38) Human (GRCh38)
Location 4:88620768-88620790 4:88620784-88620806
Sequence CCCTCCTCAGAGTGTTTACCCTG TACCCTGCTATTCTGTAACTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 202} {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!