ID: 976768205_976768213

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 976768205 976768213
Species Human (GRCh38) Human (GRCh38)
Location 4:88620768-88620790 4:88620812-88620834
Sequence CCCTCCTCAGAGTGTTTACCCTG ATCTAGGACCTATGTTCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 202} {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!