ID: 976837870_976837872

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 976837870 976837872
Species Human (GRCh38) Human (GRCh38)
Location 4:89396366-89396388 4:89396382-89396404
Sequence CCTTCTGAGTATTCTACCTTATA CCTTATACCCATGAATTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 210} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!