ID: 976888044_976888051

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 976888044 976888051
Species Human (GRCh38) Human (GRCh38)
Location 4:90009612-90009634 4:90009657-90009679
Sequence CCAAGTATCTGCTGTCTTCAAGA CCACATAAACTTAAGGTAAAGGG
Strand - +
Off-target summary {0: 128, 1: 271, 2: 470, 3: 835, 4: 1680} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!