|
Left Crispr |
Right Crispr |
| Crispr ID |
976994841 |
976994845 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:91417780-91417802
|
4:91417816-91417838
|
| Sequence |
CCACCGTGACACATGTTTACCTA |
CACATTGTGCACGTGTACCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 187, 2: 1860, 3: 6362, 4: 10367} |
{0: 4, 1: 28, 2: 152, 3: 749, 4: 1141} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|