ID: 976994843_976994845

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 976994843 976994845
Species Human (GRCh38) Human (GRCh38)
Location 4:91417799-91417821 4:91417816-91417838
Sequence CCTATGTAACAAACCTGCACATT CACATTGTGCACGTGTACCCTGG
Strand - +
Off-target summary No data {0: 4, 1: 28, 2: 152, 3: 749, 4: 1141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!