ID: 977020631_977020639

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 977020631 977020639
Species Human (GRCh38) Human (GRCh38)
Location 4:91754852-91754874 4:91754904-91754926
Sequence CCATGTGAGTCAGGAAGTAGATC CTGCAGCTTTGGCCAACAGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!