ID: 977217308_977217320

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 977217308 977217320
Species Human (GRCh38) Human (GRCh38)
Location 4:94297736-94297758 4:94297766-94297788
Sequence CCCCCTAGAAAAGCAGGACTTGC GGTGAAGGAGAAGGGGTTGAGGG
Strand - +
Off-target summary No data {0: 375, 1: 236, 2: 100, 3: 101, 4: 1002}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!