ID: 977217308_977217321

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 977217308 977217321
Species Human (GRCh38) Human (GRCh38)
Location 4:94297736-94297758 4:94297767-94297789
Sequence CCCCCTAGAAAAGCAGGACTTGC GTGAAGGAGAAGGGGTTGAGGGG
Strand - +
Off-target summary No data {0: 407, 1: 144, 2: 39, 3: 71, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!