ID: 977217310_977217315

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 977217310 977217315
Species Human (GRCh38) Human (GRCh38)
Location 4:94297738-94297760 4:94297757-94297779
Sequence CCCTAGAAAAGCAGGACTTGCCG GCCGCTAAGGGTGAAGGAGAAGG
Strand - +
Off-target summary {0: 13, 1: 152, 2: 413, 3: 413, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!