|
Left Crispr |
Right Crispr |
| Crispr ID |
977217310 |
977217318 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:94297738-94297760
|
4:94297759-94297781
|
| Sequence |
CCCTAGAAAAGCAGGACTTGCCG |
CGCTAAGGGTGAAGGAGAAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 152, 2: 413, 3: 413, 4: 271} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|