ID: 977217311_977217319

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 977217311 977217319
Species Human (GRCh38) Human (GRCh38)
Location 4:94297739-94297761 4:94297765-94297787
Sequence CCTAGAAAAGCAGGACTTGCCGC GGGTGAAGGAGAAGGGGTTGAGG
Strand - +
Off-target summary {0: 68, 1: 346, 2: 425, 3: 284, 4: 202} {0: 458, 1: 207, 2: 56, 3: 137, 4: 1396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!