ID: 977337993_977338000

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 977337993 977338000
Species Human (GRCh38) Human (GRCh38)
Location 4:95721960-95721982 4:95721992-95722014
Sequence CCATGTTTGTTCTGGGGTAGGGG CCACCCTGGTTAGCTGAAAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!