ID: 977426002_977426008

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 977426002 977426008
Species Human (GRCh38) Human (GRCh38)
Location 4:96867888-96867910 4:96867921-96867943
Sequence CCTAAGGCCATAAAAGCCCTGGA GGCAATATCATTCAGGACATAGG
Strand - +
Off-target summary No data {0: 286, 1: 9224, 2: 11597, 3: 4473, 4: 2319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!