ID: 977430763_977430767

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 977430763 977430767
Species Human (GRCh38) Human (GRCh38)
Location 4:96928182-96928204 4:96928220-96928242
Sequence CCTGCCATCTTCTGCAGATACCT GACAGCTTTTGGCCTCTTACTGG
Strand - +
Off-target summary {0: 2, 1: 185, 2: 198, 3: 122, 4: 306} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!