ID: 977466897_977466905

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 977466897 977466905
Species Human (GRCh38) Human (GRCh38)
Location 4:97393775-97393797 4:97393812-97393834
Sequence CCGCCTCCTGGATTCACGTGATT TCCTGAGTAGCTGGGATTATAGG
Strand - +
Off-target summary No data {0: 4909, 1: 66666, 2: 155807, 3: 234511, 4: 197419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!