ID: 977466899_977466905

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 977466899 977466905
Species Human (GRCh38) Human (GRCh38)
Location 4:97393781-97393803 4:97393812-97393834
Sequence CCTGGATTCACGTGATTCTCCTG TCCTGAGTAGCTGGGATTATAGG
Strand - +
Off-target summary {0: 10, 1: 2391, 2: 44337, 3: 154560, 4: 208118} {0: 4909, 1: 66666, 2: 155807, 3: 234511, 4: 197419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!