|
Left Crispr |
Right Crispr |
Crispr ID |
977466899 |
977466905 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:97393781-97393803
|
4:97393812-97393834
|
Sequence |
CCTGGATTCACGTGATTCTCCTG |
TCCTGAGTAGCTGGGATTATAGG |
Strand |
- |
+ |
Off-target summary |
{0: 10, 1: 2391, 2: 44337, 3: 154560, 4: 208118} |
{0: 4909, 1: 66666, 2: 155807, 3: 234511, 4: 197419} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|