ID: 977569718_977569719

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 977569718 977569719
Species Human (GRCh38) Human (GRCh38)
Location 4:98616526-98616548 4:98616555-98616577
Sequence CCAAGAGGCGCTGGATGGCAAGA AAGCACAGCCTCCACTCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 118} {0: 1, 1: 1, 2: 0, 3: 24, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!