ID: 977859716_977859719

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 977859716 977859719
Species Human (GRCh38) Human (GRCh38)
Location 4:101942068-101942090 4:101942106-101942128
Sequence CCAAAGAGAGATCAGGAAGAATG GTCAGCAGGACTGAAACATCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!