ID: 977978559_977978572

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 977978559 977978572
Species Human (GRCh38) Human (GRCh38)
Location 4:103296063-103296085 4:103296111-103296133
Sequence CCCTAAAACCATAAAAACCCTAG GGACATAGGCATGGTGGGCAAGG
Strand - +
Off-target summary {0: 44, 1: 99, 2: 75, 3: 99, 4: 397} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!