ID: 977978560_977978572

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 977978560 977978572
Species Human (GRCh38) Human (GRCh38)
Location 4:103296064-103296086 4:103296111-103296133
Sequence CCTAAAACCATAAAAACCCTAGA GGACATAGGCATGGTGGGCAAGG
Strand - +
Off-target summary {0: 12773, 1: 6286, 2: 3517, 3: 3334, 4: 4461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!