ID: 977978563_977978572

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 977978563 977978572
Species Human (GRCh38) Human (GRCh38)
Location 4:103296080-103296102 4:103296111-103296133
Sequence CCCTAGAAGAAAACCTAGGCAAT GGACATAGGCATGGTGGGCAAGG
Strand - +
Off-target summary {0: 8236, 1: 10604, 2: 3986, 3: 1968, 4: 1273} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!