ID: 977978566_977978572

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 977978566 977978572
Species Human (GRCh38) Human (GRCh38)
Location 4:103296093-103296115 4:103296111-103296133
Sequence CCTAGGCAATACCATTCAGGACA GGACATAGGCATGGTGGGCAAGG
Strand - +
Off-target summary {0: 8513, 1: 11095, 2: 4149, 3: 2051, 4: 1564} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!