|
Left Crispr |
Right Crispr |
| Crispr ID |
978180033 |
978180041 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:105782667-105782689
|
4:105782704-105782726
|
| Sequence |
CCTCCTCCTGGGTTCAAACGATT |
CCCCTAGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 667, 1: 17806, 2: 62788, 3: 103910, 4: 128210} |
{0: 162, 1: 6363, 2: 112471, 3: 263921, 4: 243656} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|