|
Left Crispr |
Right Crispr |
| Crispr ID |
978180034 |
978180039 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:105782670-105782692
|
4:105782696-105782718
|
| Sequence |
CCTCCTGGGTTCAAACGATTCTC |
CCTCAGGTCCCCTAGTAGCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1012, 1: 28064, 2: 97665, 3: 163311, 4: 198599} |
{0: 1, 1: 25, 2: 965, 3: 23156, 4: 244523} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|