|
Left Crispr |
Right Crispr |
Crispr ID |
978180034 |
978180041 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:105782670-105782692
|
4:105782704-105782726
|
Sequence |
CCTCCTGGGTTCAAACGATTCTC |
CCCCTAGTAGCTGGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1012, 1: 28064, 2: 97665, 3: 163311, 4: 198599} |
{0: 162, 1: 6363, 2: 112471, 3: 263921, 4: 243656} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|