ID: 978186174_978186178

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 978186174 978186178
Species Human (GRCh38) Human (GRCh38)
Location 4:105858896-105858918 4:105858940-105858962
Sequence CCACACTCACTCAATTATTGCAG CCAGCGGGCTGTTTTCTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 240} {0: 1, 1: 0, 2: 1, 3: 5, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!