ID: 978328875_978328885

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 978328875 978328885
Species Human (GRCh38) Human (GRCh38)
Location 4:107590018-107590040 4:107590071-107590093
Sequence CCTTCTTATTCTTATGTAAATAT GGGGACAAAGCTGGACTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 50, 4: 782} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!