ID: 978343633_978343641

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 978343633 978343641
Species Human (GRCh38) Human (GRCh38)
Location 4:107742659-107742681 4:107742690-107742712
Sequence CCAACATGAAGAAACCCCCTCTC ATGCAAAAATTGGCTGGGCGTGG
Strand - +
Off-target summary {0: 11, 1: 745, 2: 21376, 3: 113440, 4: 157016} {0: 6, 1: 792, 2: 20300, 3: 71105, 4: 103060}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!