ID: 978529946_978529954

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 978529946 978529954
Species Human (GRCh38) Human (GRCh38)
Location 4:109703094-109703116 4:109703112-109703134
Sequence CCCCGGCGCCGGCGTCGCTACTC TACTCGGGACCGCCAGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 43} {0: 1, 1: 0, 2: 1, 3: 5, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!