|
Left Crispr |
Right Crispr |
| Crispr ID |
978569791 |
978569795 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
4:110124312-110124334
|
4:110124361-110124383
|
| Sequence |
CCACTAATGATGGACTGGACAAA |
AACACTATGCAGCCATAAAAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 34, 3: 620, 4: 6379} |
{0: 77, 1: 2735, 2: 2749, 3: 3798, 4: 5082} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|