ID: 978578722_978578731

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 978578722 978578731
Species Human (GRCh38) Human (GRCh38)
Location 4:110211771-110211793 4:110211820-110211842
Sequence CCCAGTGGGCTGCCTTTTCCAAC CATCAGAGAGAGACCATGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!